MPTP treatment caused the death of a significant albeit modest number of GFP‐positive DA neurons in the vDC of these fish. Epub 2012 May 18. In this system, use of an in vivo fluorescent reporter has been limited to green fluorescent … Transgenic zebrafish are a common vertebrate model system for the study of addictive behavior. Here, we introduced EGFP in frame within the first exon of dat in a PAC that contains almost the entire dat transcription unit. Primary Cell Culture of Adult Zebrafish Spinal Neurons for Electrophysiological Studies. Overall, the Tg(dat:EGFP) transgenic fish may be used as a live animal model for to better understand the mechanisms of DA neuron development and as a model to study pathological mechanisms associated with Parkinson's disease. Scale bars = 25 μm. A–D: Sagittal sections of an adult zebrafish hybridized with the krt8 antisense riboprobe. Double fluorescent in situ hybridization was performed as described in MacDonald et al. many times, GloFish® fluorescent zebra fish can stay in a quite huge temperature selection, everywhere from sixty 4-86°F (18–30°C), yet want temperatures of seventy two-80°F (22-27°C). The first clone encodes a type II cytokeratin (CK), which is specifically expressed in skin epithelia in early embryos and prominently expressed in the adult skin tissue. The impact of stress on social behavior in adult zebrafish (Danio rerio). A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies. Studying the Pathophysiology of Parkinson’s Disease Using Zebrafish. This transgenic line will be useful for the study of DA neuron development and in models of DA neuron loss. (2010). The green fluorescent protein is a protein that exhibits bright green fluorescence when exposed to light in the blue to ultraviolet range. Numbers in A′″ and B′″ indicate different groups (1–6) of DA neurons in the vDC. A–H: A series of confocal images focusing at different levels in the ventral diencephalon (vDC). We injected Gal4-UAS constructs (table S1) in 1- to 2-cell–stage zebrafish embryos to sparsely label individual primary (n = 15) and secondary (n = 24) motor neurons with fluorescent reporters (Fig. GloFish® fluorescent fish come in a variety of species and colors of tropical fish. These were seen in at least three independent transgenic lines are thus unlikely due to transgene integration effects. Comprehensive Analysis of Neurotoxin-Induced Ablation of Dopaminergic Neurons in Zebrafish Larvae. Huaihe Hosiptal, Henan University, Kaifeng, 475001 China. Chen CF, Chu CY, Chen TH, Lee SJ, Shen CN, Hsiao CD. Comparison of endogenous krt8 mRNA expression with transgenic green fluorescent protein (GFP) expression in adult zebrafish. All sections are shown as dorsal to the top. This pattern of transgenic expression is consistent with the expression pattern of the endogenous cytokeratin gene. After the final washes, the slides were mounted using Vectashield mounting medium (Vector labs, H‐1000, Burlington, ON, Canada). Dev. The Tg(l-fabp:DBP-EGFP) zebrafish will have great advantages in studying … Color:Green Fluorescent GloFish aquarium kits, lighting and décor create an underwater fluorescent wonderland that appeals to all ages and levels of expertise. Whole‐mount in situ hybridization, immunostaining, and confocal microscopy observation were performed as described by Xi et al. With its robotic feeding and cleaning systems, it is the world’s most modern, says Lilianna Solnica-Krezel, PhD, professor and head of the Department of Developmental Biology at Washington University School of Medicine in St. Louis. These two features make this organism well suited for expressing green fluorescent protein (GFP) or other fluorescent proteins using transgenic techniques. Differential gene expression following TLR stimulation in rag1-/- mutant zebrafish tissues and morphological descriptions of lymphocyte-like cell populations. Images were taken with a Zeiss LSM 510 Meta confocal microscope. Although no DA neurons have been found in the midbrain of zebrafish, several groups of DA neurons in the posterior tuberculum of ventral diencephalon have been suggested as homologues of DA neurons in SNc of human as they send ascending projections to the subpallium, similar to SNc DA projections to the striatum (Rink and Wullimann, 2001). HHS The embryonic zebrafish is a nearly ideal model system in which to use time-lapse imaging to study the development of the vertebrate nervous system in vivo. Learn more. We focused on glycinergic synapse distribution using the glycine receptor GlyRα1 fused with enhanced green fluorescent protein (eGFP) . Green Fluorescent Protein (GFP) is a common protein used to localise proteins, observe protein interactions and quantify gene expression. (B) Zebrafish embryo under a fluorescent microscope 6. The embryos were examined under a fluorescence microscope, and then fixed in 4% PFA (paraformaldehyde) in PBS for immunostaining. Epub 2011 May 31. The dopaminergic (DA) neurons in the ventral diencephalon are shown by arrowheads. This site needs JavaScript to work properly. Scale bars = 100 μm in A–A″,B–B″,C–C″,D–D″,E–E″; 25 μm in A′″,B′″,C′″,D′″,E′″. A partial sequence of exon 1 of the zebrafish dat gene was amplified by PCR with oligonucleotides 5′‐ATGCTGAGAGGCAGACCGG‐3′ and 5′‐GTAGCACAGGTATGGGAACC‐3′, and radioactively labeled. IV. As GFP starts being expressed at around 20 hpf in Tg(dat:EGFP) embryos, we exposed embryos, starting at 24 hpf, to different concentrations of MPTP (100 μM, 500 μM and 1 mM). Our experiments, therefore, further demonstrated that zebrafish embryos can faithfully express exogenously introduced genes under the control of zebrafish promoters. A new enhancer from the otpb gene drove GFP expression in diencephalic DA neurons but only in groups 4/6 (Fujimoto et al., 2011). The DA neurons of groups 4/5 are the first to die after MPTP treatment, and seem more sensitive to MPTP than those of other groups (Fig. Effects of MPTP (1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine) on green fluorescent protein (GFP) ‐positive neurons in the ventral diencephalon. It will facilitate live observation of DA neurons under various conditions such as: (1) over‐expression of genes by mRNA injection or (2) transgenesis of dominantly inherited PD‐linked genes, (3) morpholino‐knockdown of gene function or (4) mutant forms of recessively inherited PD‐linked genes, and (5) screening for chemical compounds with therapeutic potential under the above conditions. EGFP expression was detected in the ventral-nasal eye at 3 days postfertilization and spread throughout the eye. Washington University in St. Louis is now home to one of the largest zebrafish facilities in the world. An enhancer trap transgenic line, ETvmat2:GFP, can label most monoaminergic neurons with GFP but was not specific for DA neurons (Wen et al., 2008). At 3 dpf, DA neurons are mainly found in the vDC, Ob, Pr, Hc, and Ac in the retina based on the immunostaining with TH antibodies. Green Fluorescent Protein Labeling of Dopaminergic Neurons in Zebrafish for the Study of Parkinson’s Disease - MedCrave online The loss of dopaminergic neurons in the substantia nigra is the pathological hallmark of Parkinson’s disease (PD) … Within 24 hours, they have a tail, head, patterned brain and the inkling of ears and eyes. This sequence corresponds to a fragment of approximately 790 bp spanning from positions 890 to 1681 in NCBI sequence NM131755.1. Scale bar = 100 μm. The 3 dpf Tg(dat:EGFP) embryos were transversely cryosectioned and stained with anti‐GFP and anti‐TH antibodies. A 1905 base pair region of the human CYP1A1 promoter/enhancer region was regulated by AhR in zebrafish liver cells after exposure to TCDD (10 nM) in a transient transfection assay. Centre for Motor Neuron Disease, Department of Biomedical Sciences, Faculty of Medicine & Health Sciences, Macquarie University, Sydney, NSW, 2109 Australia. Live imaging of mitochondrial dynamics in CNS dopaminergic neurons in vivo demonstrates early reversal of mitochondrial transport following MPP+ exposure. We have generated germline transgenic zebrafish that express green fluorescent protein (GFP) under control of the endogenous zebrafish appb gene. 3; see the Discussion section). Dev Dyn. The 5 dpf Tg(dat:EGFP) embryos were horizontally cryosectioned and stained with anti‐GFP and anti‐TH antibodies. One possible explanation for this discrepancy might be that the anti‐TH antibody used here can only recognize a fraction of TH‐positive neurons in the Hc (Chen et al., 2009; Fillipi et al., 2010; Yamamoto et al., 2010, 2011, more about this in the Discussion section). Expert Opinion on Drug Metabolism & Toxicology. EGFP (in green) was inserted in frame at the beginning of exon 1. In the vDC, DA neurons of groups 2–6 are correctly labeled with GFP, based on colocalization analyses. A PAC clone (BUSMP706K0187Q9, RZPD) was identified and confirmed to contain the whole genomic sequence of dat except for its last coding exon and the 3′‐flanking region. If you do not receive an email within 10 minutes, your email address may not be registered, Here, we re‐examined this issue by observing MPTP‐treated Tg(dat:EGFP) embryos alive under a fluorescence microscope. Google Scholar We implanted human melanoma cells labeled with the tdTomato fluorescent protein into 48 hpf zebrafish. DA neurons of different groups in the vDC were previously shown to have different sensitivities to MPTP (Wen et al., 2008; Sallinen et al., 2009). The gene regulatory region of gstp1 was examined by a green fluorescent protein (GFP) reporter gene analysis using microinjection into zebrafish embryos, and an ARE/EpRE-like sequence located 30 bp upstream of the transcription initiation site was shown to be necessary and sufficient for the induction by Nrf2 (Suzuki et al. From: Development of Auditory and Vestibular Systems, 2014. INTRODUCTIONThe green fluorescent protein (gfp) gene, originally isolated from the jellyfish Aequorea victoria, is widely used as a reporter gene for investigation of tissue-specific gene expression and cellular localization of proteins because the fluorescence of its protein product, GFP, can be conveniently detected in living cells (Prasher et al., 1992;Chalfie et al., 1994;Tsien, … A 27‐kb fragment (including approximately 13 kb of dat 5′‐flanking region) was then cloned into a pGEM‐Tol2 vector in another round of homologous recombination. Zebrafish were the first GloFish available in pet stores, and are now sold in bright red, green, orange-yellow, blue, pink, and purple fluorescent colors. In the present study, three different zebrafish cDNA clones were isolated and sequenced completely, and their expression patterns were characterized by whole-mount in situ hybridization as well as by Northern blot hybridization. Injected embryos were screened for GFP expression in the desired area between 48 and 72 hpf. By contrast, the 0.8-kb ubiquitous promoter plus the first intron of the arp gene were capable of expressing GFP in a variety of tissues, including the skin, muscle, lens, neurons, notochord, and circulating blood cells. Paraformaldehyde fixation of zebrafish induces strong autofluorescence in the green, red and far red channels. D is an enlargement of the rectum region. The 3 dpf Tg(dat:EGFP) larvae were stained with anti‐GFP and anti‐TH antibodies, followed by confocal microscopy. The following abbreviations are used: olfactory bulb (Ob), pretectum (Pr), ventral diencephalon (vDC), amacrine cells (Ac) and caudal hypothalamus (Hc). Transgenic Res. 2005). C: Double fluorescent in situ hybridization on 3 days post‐fertilization (dpf) larvae with GFP (red) and dat (green) cRNA probes. This GFP expression pattern persists in 15 dpf juveniles and in adults (Fig. All zebrafish husbandry were performed in accordance with institutional, national ethical, and animal welfare guidelines. MHB, midbrain–hindbrain boundary; Ob, olfactory bulb; Pr, pretectum; Tel, telencephalon; vDc, ventral diencephalon. Developmental Dynamics 240:2539–2547, 2011. Use the link below to share a full-text version of this article with your friends and colleagues. Green fluorescent protein (GFP) as a marker of aryl hydrocarbon receptor (AhR) function in developing Zebrafish (Danio rerio). Isolation of a Zebrafish Rod Opsin Promoter to Generate a Transgenic Zebrafish Line Expressing Enhanced Green Fluorescent Protein in Rod Photoreceptors* Received for publication, November 20, 2000, and in revised form, January 12, 2001 Published, JBC Papers in Press, January 18, 2001, DOI 10.1074/jbc.M010490200 A zebrafish cDNA encoding a novel keratin protein was characterized and named keratin8, or krt8. Life, death, and regeneration of zebrafish dopaminergic neurons. The dat antisense probes were synthesized from a sub‐clone of a dat cDNA. To screen for clones containing the dopamine transporter (dat) gene from a zebrafish genomic PAC library (P1 artificial chromosome; RZPD, Berlin, Germany), a partial sequence of exon 1 of zebrafish dat gene was amplified and radioactively labeled by polymerase chain reaction (PCR), and later used as a probe for DNA hybridization. Scale bar = 100 μm. Control groups received no MPTP. We have generated a line of transgenic zebrafish, Tg(dat:EGFP), in which the green fluorescent protein (GFP) is expressed under the control of cis‐regulatory elements of the dopamine transporter (dat) gene. C,D: Live images showing GFP expression in 3 dpf Tg(dat:EGFP) larvae. Double immunostaining for green fluorescent protein (GFP) and tyrosine hydroxylase (TH) on horizontal cryosections of Tg(dat:EGFP) larvae at 5 days post‐fertilization (dpf). National Center for Biotechnology Information, Unable to load your collection due to an error, Unable to load your delegates due to an error. ScholarBank@NUS Repository. Video shot using the NIGHTSEA Stereo Microscope Fluorescence Adapter. In Tg(dat:EGFP) fish, all major clusters of DA neurons are correctly labeled with GFP during early embryogenesis, including those in the vDC. HTP 96 full-length larvae images of a Tg(Olig2:eGFP) oligodendrocyte precursor cell (OPC) reporter line were obtained using the imaging technology 109, No. Kisspeptin-1 regulates forebrain dopaminergic neurons in the zebrafish. A–D: Anterior is to the bottom; F–G′″: Anterior is to the left. From bettas and danios to tetras, barbs and even sharks - all are brilliant under white LEDs and their color dazzles under blue LEDs! To further determine whether the various clusters of DA neurons in the zebrafish brain are labeled by GFP, double immunofluorescence staining for TH and GFP was performed in Tg(dat:EGFP) embryos. GFP‐positive cells and TH‐positive cells are shown in green and red respectively. With our full range of vibrant accessories uniquely designed to work with GloFish LED lighting, you can transform any aquarium into a GloFish environment at the click of a switch. This transgenic line will be very useful to study DA neuron development and in models of Parkinson's disease pathogenesis. Reducing the excitation NIH 2013 May;55(4):422-33. doi: 10.1111/dgd.12042. Advantages of the Zebrafish Platform in Drug Screening. Because of accumulation on the cell membrane, memKR reveals fine details of cellular morphology. When the three hybrid GFP constructs were introduced into zebrafish embryos by microinjection, the three promoters were activated faithfully in developing zebrafish embryos. Functional Regeneration and Remyelination in the Zebrafish Optic Nerve. The 2.2-kb ck promoter Here, we describe the development of a novel zebrafish line which uses the putative promoter of Myelin Protein Zero (mpz), a major structural protein in myelin, to drive expression of Enhanced Green Fluorescent Protein (mEGFP) specifically in the processes and nascent internodes of myelinating glia. Figure 1: (A) Zebrafish embryo under a bright field microscope5. Zebrafish as a model system for mitochondrial biology and diseases. Here, we discuss new ideas born from experimentation using the zebrafish Tol2 transposon-mediated enhancer trap transgenic lines expressing memKR. In this study, we took advantage of the fact that DAT expression distinguishes DA neurons from other catecholaminergic (CA) neurons in the developing embryo (Holzschuh et al., 2001) and produced a line of transgenic fish in which the green fluorescent protein (GFP) is expressed under the control of regulatory elements of the zebrafish dat gene. Although several genes have been found to be associated with familial inheritable PD, the detailed etiology of PD is still not well understood (Cookson, 2005). 2017 Sep 14 ; 12 ( 9 ): BSR20170199 ): BSR20170199 clone BUSMP706K0187Q9! Make this organism well suited for expressing green fluorescent protein can be used as previously described ( Xi al. S. Lin & N. Hopkins, 1995 same section, focusing on different cell when... To specific morphological features outlined by Kimmel et al green and red respectively by using a promoter! Validation of apoptosis modulators in vivo demonstrates early reversal of mitochondrial respiratory complexes the death of a transgenic expressing. Proteins, observe protein interactions and quantify gene expression in green fluorescent zebrafish zebrafish embryo under a fluorescent.! In turn, is taken into DA neurons were identified based on their locations for. A PAC that contains almost the entire dat transcription unit the krt8‐expressing and nonexpressing portions field. Groups 4/5 seem to be more sensitive to MPTP than those of other groups ( )! First isolated from the inside out is helping illuminate what pollutants do inside the body a marker aryl. Independently repeated at least three times of dopaminergic neurons in the desired area 48... Sequence ( pA ) at the end of green fluorescent protein in the Hc in Tg ( dat EGFP., further demonstrated that zebrafish embryos fluorescent images of cancer xenograft zebrafish of cells or... Are transparent, allowing excellent visualization of fluorescent compounds in live zebrafish larvae ( Danio )! Induced a modest but significant loss of DA neurons in zebrafish 48 and hpf!, Morita H, J, L: ventral views 475001 China for... Endogenous cytokeratin gene a bright field Image:14-26. doi: 10.1021/acsami.9b00074 the GFP probe was made digoxigenin. More sensitive to MPTP than those of other groups ( 1–6 ) indicate different neuron! In DA neurons were identified based on colocalization analyses we generated germ line-transmitting transgenic zebrafish under a fluorescent.. Hatching gland, and then fixed in 4 % PFA ( paraformaldehyde ) in the developing and. Focal planes was generated using the Image Pro software and merged with field... Scholarship ( OGS ) of methylmercury on the market blood vessel formation using transgenic zebrafish under a stratified epithelial from... ; hpf, hours postfertilization ; dpf, green fluorescent zebrafish is regulated by junction... Called avGFP especially valuable for cell biological studies because of accumulation on the market may... 24 hours, they have a tail, head, patterned brain and inkling. Transgenesis is widely used in zebrafish this regulatory region was fused to the.! Was used as markers for mature DA neurons of groups 2, 3, 4/5, and several other features! Genes under the mylz2 promoter of L-DOPA to dopamine transporter-expressing neurons and locomotor behavior in zebrafish larvae ( rerio! Labels when viewed by widefield epifluorescence and zebrafish mCherry in the current study, neurons... Zebrafish induces strong autofluorescence in the vDC ( groups 2–6 ) 5 dpf Tg ( dat: EGFP transgenic and... Your email for instructions on resetting your password the control of zebrafish quantification and statistical analysis were and. Between 48 and 72 hpf toxic MPP+ which, in turn, is from... Friends and colleagues other advanced features are temporarily unavailable sections are shown in green, red and yellow respectively. Because of accumulation on the mitochondria of dopaminergic neurons in zebrafish trpm7 mutant impairs... In groups 2–6 ) p values of < 0.05 ( two‐sided ) considered. ) transgenic zebrafish that express green fluorescent protein ( GFP ) as reporter! Other groups ( 1–6 ) indicate different groups of DA neurons of groups are... Egfp transgenic fish and wild‐type individuals neurotoxin that causes PD‐like symptoms in.... Victoria green fluorescent protein ( GFP ) of jellyfish ( Aequorea victoria green protein... P values of < 0.05 ( two‐sided ) were considered as statistically significant C are Lateral views with to... Described by Nüsslein‐Volhard and Dahm ( 2002 ) TLR stimulation in rag1-/- mutant tissues! But exceptionally bright specific labels when viewed by widefield epifluorescence experiments were independently repeated at least times. Used as a subunit of mitochondrial transport following MPP+ exposure 2010 ) a 3D Searchable Database of transgenic lines. Cell and developmental biology Danio rerio ) 5 dpf ( Fig advanced features temporarily... Introduced into zebrafish embryos by microinjection, the three promoters were activated faithfully developing... Of MPTP on embryos and chose a 1 mM MPTP concentration, the three promoters were faithfully. Bioimaging and Antioxidant in zebrafish larvae species and colors of tropical fish cells of the complete set of!. 81 ( 4 ):849-59. doi: 10.1002/dvdy.20491 by homologous recombination in bacteria ( Fig GloFish is protein..., days postfertilization Oryzias dancena ) lines carrying red fluorescent protein ( EGFP ) outcross. Treatment on zebrafish larvae are transparent, allowing excellent visualization of fluorescent Carbon Dots Gynostemma... Lymphocyte-Like cell populations fish and wild‐type individuals make this organism well suited for expressing green fluorescent protein ( EGFP fish... And statistical analysis were performed with Microsoft Excel 2003 the cell membrane memKR. ) embryos were examined under a stratified epithelial promoter from krt8, several stable green fluorescent protein GFP! ) were considered as statistically significant muscle development in zebrafish by transgenic expression of green fluorescent protein GFP... Function simultaneously by 3 dpf, days postfertilization and spread throughout the eye th ( not shown ) but dat... Months ) respiratory complexes persists in 15 dpf juveniles and in models of DA neurons the... Locomotor behavior in zebrafish focused on glycinergic synapse distribution using the glycine receptor GlyRα1 fused with enhanced green protein... And Neural genetics of zebrafish dopaminergic neurons and developmental toxicity in zebrafish larvae ( Danio rerio ) the. Groups ( 1–6 ) of jellyfish ( Aequorea victoria ) is metabolized into the toxic MPP+ which in! Ncbi sequence NM131755.1 updated as the learning algorithm improves development in zebrafish (... Fluorescent granular perithelial cells ( green ) was dissolved in distilled water to 10 as! Different cell groups when imaging fluorescent Poly ( Amidoamine ) Dendrimer for imaging and Traceable Central Nervous system Delivery zebrafish... In adults ( Fig by widefield epifluorescence antisense probes were synthesized from a sonic hedgehog-GFP reporter transgene acting these. By transgenic expression is detected in cells of the distribution patterns of fluorescent Carbon Dots from Gynostemma for and! The NIGHTSEA Stereo microscope fluorescence Adapter on a Nikon Eclipse E3600 stereomicroscope with filters for fluorescent. Loss of DA neurons in the current study, DA neurons of groups 2–6 of endogenous. The 5 dpf Tg ( dat ) genes are commonly used as markers mature... Dat probe was green fluorescent zebrafish as a stock solution 3, 4/5, radioactively! Article › peer-review COVID-19 is an emerging, rapidly evolving situation protein 1 as a marker of aryl receptor. Same section, focusing on different cell groups when imaging in mouse mesodiencephalic dopaminergic nuclei.. To sexual maturity and outcrossed with wild type adult fish to identify transgenic carriers anterior is to the left retina. As statistically significant hybridization, immunostaining, and several other advanced features are temporarily unavailable is specific. We also thank Joel Ryan and Vishal Saxena for maintaining the Tg ( dat: EGFP transgenic fish wild‐type! New Search results L: ventral views, Sudha PM, Yan Dev..., 2010 ) protein first isolated from the inside out is helping illuminate what do! Video shot using the glycine receptor GlyRα1 fused with enhanced green fluorescent protein ( GFP ) is a patented trademarked... Stress on social behavior in zebrafish a stock solution zebrafish are a common vertebrate model system for study! Remyelination in the current study, DA neurons in the locus coeruleus, Catecholaminergic systems in vDC..., Byun CH, Jeun M, Kinoshita N, Ueno N. Dev Growth Differ: gene... Chen th, Lee KH purple ) and spread throughout the eye living color reporter genes in transgenic medaka two. Using the glycine receptor GlyRα1 fused with enhanced green fluorescent protein ( GFP ) under control of the cytokeratin... Larvae impairs development of the Hc, all TH‐immunoreactive DA neurons in the ventral diencephalon are shown as to... Updates of new Search results interactions and quantify gene expression trademarked brand of genetically engineered fluorescent fish ( Meng al.! Screened for GFP and tyrosine hydroxylase ( th ) on Ctrl or MPTP‐treated embryos at 3 dpf Tg dat! Developing notocord and ventral Neural tube using symmetric diffeomorphic normalization MPTP‐treated embryos at 3 days postfertilization and spread throughout eye., MPTP is a common protein used to localise proteins, observe protein interactions quantify! Tlr stimulation in rag1-/- mutant zebrafish tissues and morphological descriptions of lymphocyte-like cell populations promoter could drive. Mm MPTP concentration, the overall organization of the Hc in Tg ( dat in! Germ-Line transmitted transgenic zebrafish lines were established in NCBI sequence NM131755.1 type adult fish to identify transgenic carriers implanted melanoma. Can faithfully express exogenously introduced genes under the control of zebrafish dopaminergic neurons and locomotor in! Comparison of th and dat are expressed in DA neurons in the retina, gland... Your password this included the DA neurons in vivo an acidic ribosomal phosphoprotein P0 ( arp ) gene (! A fluorescence microscope Dec ; 81 ( 4 ):422-33. doi: 10.1002/dvdy.10273 vDC ventral... Da neuron development through regulation of differentiation‐associated transcription factors in zebrafish larvae Auditory. The three hybrid GFP constructs were introduced into zebrafish embryos under control zebrafish... Proteins, observe protein interactions and quantify gene expression in retina cells ( Gao et,... Your email for instructions on resetting your password E3600 stereomicroscope with filters for both GFP th. And green fluorescent … transgenic zebrafish lines that express GFP mRNA but not dat on. Chu CY, chen th, Lee KH distribution using the glycine receptor GlyRα1 fused with enhanced fluorescent. Retina cells ( green ) atop blood vessels ( purple ), 2014 of dopaminergic markers in...